NIA Mouse Gene Index (mm92)

Exon structure for U038821

chr19 -

Exon1 11239810 - 11239762
	ACCACGGTTGCTCTGAGACACAACCGCAGCTGCGCTGGATCCGCAAGAG
Exon2 11239540 - 11239461
	TACAACCCTCCAGGTGATTCTTGTCACTTAGAAGAGCCTTTGAAGTTTATTACATTTTTTTGTAAGTCATCGCATAACGG
Exon3a 11237981 - 11237890
	GAGAGGAACTTATCCTCACATCCCTCCATTATATCTTGATGAATATGCCACAGAATCGTTTGTGGATAAAAAAGGAACTGAGAGTCTTGGGG
Exon3b 11237889 - 11237868
	GTAAGAACAAAATGCTGCTCAA
Exon4 11233668 - 11233536
	AAGCCTGATTATACAGAGCCTAGGATACTTCTGGACATACCTGTTCTTTTCTCAAAGTATTGTATTTGGACTGGGAAGCAATTATCCTCCTATCATAGGA
	ACTTCAGGATACACACTTTGGGCCTCCTTGCTT
Exon5 11221275 - 11221219
	TTTAGCCTATCAGGAAGTTTATCAATAATACTACAGAAGAGGCCTTCAAATCATACG
Exon6 11216943 - 11216827
	CTGATCTGGACCATGACAATGAATATCCTAAGCATCTTCGCAACACTAGTTGGTTTGTTTTTAACAACAGTCGAAATGATAGTGACTTCAAGTGTATATT
	CTACCCTGTGGCAATAT
Exon7 11216128 - 11216017
	AAGAGTGGCAGGGTGCTTACAGAATATCTGTTCCTGTTCAGCATGTTGGAGTTGTTCATGGCATCCATAGTAACTGAGTGGACCTATAGAGCAAGACAAA
	TAGAATAAAACA
Exon8 11214296 - 11214154
	TGTTAAGAGGAGTATCACGGCCTCAGTCAAGGAGTTGATGAGTGAAGAACTTTGTTCAAGAGACACCTTGGAAAGTGGTATTTTATCAAGTCTTCCTCAG
	CATTTCATCTCCTGCATTTCATTAATAAAAACTGATAGCAATG

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+5dbEST_BU962923.1,ENSMUST00000078770,REF_NM_027074.3,GB_AK006335.1,GB_BC061241.1,
23a+5dbEST_BU962923.1,ENSMUST00000078770,REF_NM_027074.3,GB_AK006335.1,GB_BC061241.1,
13a+2dbEST_CA466362.1,GB_BC048529.1,
3a5+3ENSMUST00000078770,REF_NM_027074.3,GB_AK006335.1,
45+1dbEST_BU935808.1,
3b5+4dbEST_BU962923.1,dbEST_CA466362.1,GB_BC048529.1,GB_BC061241.1,
56+8dbEST_BU935808.1,dbEST_BU962923.1,dbEST_CA466362.1,ENSMUST00000078770,REF_NM_027074.3,GB_BC048529.1,GB_AK006335.1,GB_BC061241.1,
67+9dbEST_BU935808.1,dbEST_BU962923.1,dbEST_CA466362.1,dbEST_L26625.1,REF_NM_027074.3,GB_BC048529.1,GB_AK006335.1,GB_BC061241.1,
78+18dbEST_AV261116.1,dbEST_AV269691.1,dbEST_AV210963.1,dbEST_AV268975.1,REF_NM_027074.3,GB_BC048529.1,GB_AK006335.1,GB_BC061241.1,