NIA Mouse Gene Index (mm92)

Exon structure for U039257

chrX -

Exon1 9794046 - 9793678
	AGAAGTAGATGCGCTCCAGAGTCTGCAGCATGGCCGCTTCCAATCGCGACCGCTAGAGGGTGTGCGGTCGCTTACCGCCGCGACCATGGCATCTGCGCTT
	GCGCCTCACTGACACAGCTTCCGCCAGCCTCCTTCCAAAAGCCTTTCGCCCCTCCCCGCCCCGCAAGGCTCCGCCTCCGTTGCCCCTAGCGTCTGTTTGT
	TGACTTCCGGGAGCACAGTAGTGGTCTATGCCAAGAGGGTCGCGATGGGGGTCCCAGGGGGTAGGGCAGCACCTTAGGCTCAATCGAGTCGCCCCTGCTA
	TCTTTCCGAAGCAGGCACAGATTCCGTTCGCAGGCTTCGGCATGGCGGAATCTGAGTCACTGGTGCCCG
Exon2 9793608 - 9793342
	AGGCCAGGCCCCGCCTCCGAGCCGGCCCCGTAGTGGTACAGGCCGCAACCTGAGCCTCAGTCAACCGCCTTAGATTTGCGTTTGGGAATAAATAAATTCC
	CTTTGTCGGGCTGGAGGAAGGGACAGGGACATGAGGGACCCTGTGTGTGTTATTAGCAAGCTGAAATAATGGCTTTTCTTGGAGGCGGCGGCAGCCATTA
	TTCTCTCGCGAAGCATCCCAGGGTCTCTAAACATTTGAGCAAGCGGATGTCCCCAGGACCCGGTTAG
Exon3 9792485 - 9792351
	ATCAGACAATGGCAGTTGAAGAATGTCAAATCTCAGCCTCCATCTCCAATCCCCATGGACTGATCCGTAGCTTGAACTCTCATTTCTTCTCAATGGGAAC
	AGGAATACCCGAGGTGTTTCCGTAGTAAAACCTGG
Exon4 9790780 - 9790655
	ATACAGGTGCTGTGTTTACGTTTGGAAAAACTAAATTTGCCGAAAATATTCCTAGCAAATTCTGGTTTAAAAATGACATACCCATATGTCTTTCATGTGG
	AGATGAACATACTGCTATTGTTACAG
Exon5 9789943 - 9789851
	GAAATAATAAATTGTACATGTTCGGCAGTAACAACTGGGGTCAGTTAGGATTAGGATCAAAAGCTGCTATCATCAAGCCAACATGTATCAAAG
Exon6 9788986 - 9788924
	CTCTTAAGCCTGAGAAGGTGAAACTTGCTGCCTGTGGAAGGAACCACACCTTAGTTTCAACAG
Exon7 9787883 - 9787725
	ATACTGGTGGCGTATATGCAGCTGGTGGAAATAATGAAGGTCAACTGGGGCTTGGTGACACTGACGATAGAGACACCTTTCATCAAATTGTCTTCTTTAC
	ACCTGCTGATACCATTAAACAGCTCTCTGCTGGCGCCAATACATCCGCTGCTCTTACTG
Exon8 9785948 - 9785799
	AGGATGGAAAACTTTTTATGTGGGGTGACAATTCTGAAGGGCAGATTGGTCTAGAAGATAAAAGTAATGTATGTATCCCTCATGAAGTGACTGTTGGAAA
	GCCAATTTCCTGGATCTCTTGTGGATATTACCATTCAGCTTTTGTAACAA
Exon9 9783407 - 9783249
	TGGATGGGGAGCTCTACACATTTGGAGAACCCGAGAATGGGAAGTTGGGCCTTCCCAATGAGCTGCTGATGAATCACAGATCACCCCAGCGTGTGCTGGG
	CATTCCTGAGAGGGTCATTCAAGTGGCCTGTGGTGGAGGGCACACTGTGGTTCTCACAG
Exon10 9779291 - 9779136
	AGAAAGTTGTGTATGCCTTTGGGCTGGGGCAGTTTGGACAACTGGGCCTTGGCACTTTTCTCTTTGAAACATCAGAACCCAAAATTATTGAGCGTATTAA
	GGATCAGAAAATATGTCATATTTCCTGTGGAGAAAACCATACAGCTTTGATGACAG
Exon11 9776161 - 9776037
	AACTAGGCCTCCTGTATACTTTTGGAGACGGCCGACATGGAAAGTTAGGACTTGGGATGGAGAATTTCACCAATCAGTTCTTTCCTACCTTGTGCTCTAA
	CTTTTTGAGATTTGCAGTTCAATTG
Exon12 9773280 - 9773098
	ATTGCCTGTGGTGGATGTCATATGCTAGTTTTTGCCACTCCACGACTTGGTACAATAGATGAACCTAAATTTGAAGACGTATATGAGCCTTATATAAGTA
	CAGGTTCTTTTTCCATCAATGACCTCTCCCCAAGAAGTTCACTGAATAGATCTTTATCAGCACGTCTGCGGCGAAGAGAGCGG
Exon13 9772109 - 9771944
	GAGAGACCCCCATGCTCAGCTTCAATGGTGGGAACACTGCCTCCATTAGAGGGGACTTCTGCCTCCACTTCAGCTTATTTTTACCCCAGTTCACCCCCCT
	TCCATTTGTCTGTGAATAACTACCCAGAGAAAAGCCCCTCTGAATCAATGGAGCCACTGGACTCAG
Exon14 9759178 - 9759081
	ATTATTTTGAAGATAAAATGAACAAAGACACAGAGACAGAAAATTCTTCAGCAGTGGATTCAGAAAACTTTGGTGAAACTAATGATATCTTAAATATG
Exon15 9755462 - 9755397
	ACACATATGATGACTACGAGTTCCAATGAGAAGTTATTAGATTTTTCACCAATTCAAAAACAACAG
Exon16 9754007 - 9753129
	AATCAAGACACATTTGAGAAAGTGATGGAAAGTACACCGTGCACTGAAAATGAGGATAGTTATGAATATGAAGAAATGTCAAAAATAAAAGAAGTGACAG
	TGTACAAACAATATTTAGCAAAAGGGATCTACATGATACGACCAGCCGAGATTCTGGAAGCATTTTCAGATGAGGAAGTGGGTAATGGCCTAGACCAGGT
	GGAGGAGCCGCGGGTCTTCACTGATGGAAAGGGCTTACAAAGCAAGCAAGTAGGAAAGGAAAGTGATGAAGAAATAGTCTCTGAGAAGAAAACTGAGGTG
	ATGGAAGTGGCAGATGTGAAAAAGATTAGAGAAAGTGAAGAGAACTCAAAATCAGATTCACTTTTTGATGACTTACCAGATAAAACCATGAATTCTGAGA
	GTGAAGACAATAAAGATATTGCTGAGGAAAGGAGAAGCAGTGAGCAGAATATGACCTTTGACAGTGAAACAGAATTGGTAGAAGAACCAGACAGTTACAT
	GGAATGTGAGAGGCACAGTGAGCAAGACAGTGCTGAGGAGTTGGAGCAGCCCAAGCTAGTAGAATATAGTAGCGAAgagaaagatgagaaagatgagaaa
	gatgaCGATGAAGTGGAGACTGAGAACTTATGGTACGACAGGAACTGTACTGAGCAAGAAACTGAGAATGTATTCAGAGCAACCAGATTTTTCCCAAAGT
	TCGATCTTAAGCATGATCATTTGTCAGGGATACCAGAGGAGCAGGAAGGACCAGAGGATTCAGAAGGAAATGTAGTAGTGGAGCAAGTAGTACAGGCACA
	AAAGGAAAATTTGGAATTTGAAGGAGACAGAAAGGAGGCAAAAGCAGAAGCCCCATCAGATGTCATTACAGAAAAAGAG
Exon17 9743402 - 9743202
	GCTCCTCAACTTTCAGAAACTGTGAAACCAGAAGAAGGGGAAATGGATGAGGAAATTAGTATCCTGAATGTAGAAGACACTGTAGAAGAAGAAAGGAAGG
	AAGGAGAGAAGGAGATTGTAGAAGAAGGAAGTATACCTGAAACAGAAGGCTCAGAAACTATTGATATTACTGATGAGAAGCTAGATGAAGTCCTTAAAGA
	G
Exon18 9741905 - 9741848
	GAAGACAGTGCCAGCCTTCTGCAACGGGCCCTTCGTGAGTACAATGAAAATCCAAAAG
Exon19 9739816 - 9739728
	GACACATGTATGATCGTGTAAAGAGCAGCTCTTCAGAAATTCTGGGAGGTAATGATCCAACAAGTAAAGACATAAAAAAAGCTAAAAAA
Exon20 9737906 - 9737734
	TCCTAGGTAAGCGTCAGTCTATGCCTAGAAAACGCTTCCTGGACTCTCGCTTAGGTCTGAAGCGGCTGCTGCTCAGGGTCTCTGTTAAGGCTTGCCTGTC
	CACACTGCTCATAGGAACGTCAGCTCCCTCTACAGCATGCCTCTTCTTCATTAAAGCTCAAGTGGCACATGCT
Exon21a 9736006 - 9735976
	ATTTCCTTCTTTAATCGGATGTCATTGACAG
Exon21b 9735975 - 9735342
	GTCAGAAACTGATGCAGAATACTAATGATCCACTCCCAGAGATAAAGCCAATAGGAGATCAGATAGCCTTACAAAGTGATAAGAAAGATGCCAACCAGAA
	CCACATGGGTCAAAATCTTCAGGATTCGACAACACCAAATATGGAGGGAAAGTCCAAATCCTGTACAATTCTATAAATGCATGTTTATGTTTCAATGGTC
	ACCGAGCACATTTGTTCTTCATACTTGAAAAATGGTGTGACTTCTGAAGAAAATCCCCTGACAACACTGTTTAAAAAGGTATAAATTAGTATGTTTGGCT
	TGGTTTGAACAATATGAACAGTTTTAATATTTATTTATGTTAATATTCTTAACAGTTTCCAAAGTATGTGTACCTCCAACTCTCTTTGAAGTGTTCTGGC
	CTTACAACTGCTCAGTGTTGCATAAAACAATCTATTTTTATATTTGAAAGACGAATGAAGCTATTTCATAGTTTTGCCAACACAGTTATTGTACTTTGTA
	ATTTCCTAAGACAATGTTCACAATATTACGACACTGGAACAGTTTTGAGTATATTTACAACATTTAAAAACAGGGACCATTGTAATGAACTTATTTTAAT
	AAACTATGTCTGGTTGGTTCTGCTGTCAAAATGG
Exon22 9694835 - 9694570
	GAGGGCAGGCCCTGACTAGAGGGAGGGAAAGAAGGAATCCACCAAGGAGGAGTTTTCCAGCCTGGCTTTAGAGGCTCTGTCTCACTACACAGCCCCTCGG
	TCTCTTGGCCTCCTCCAGCCCCTTAAGTGAGCTGTGCAGCCTGCCCTGCGGGGGAAGCGCCGGCTCACCATGGGGAGCCCGGGACTTCGGCCCGAgctgc
	tgctgcctcaagtactgccgctgttgctggcgctgctgcACGTCCTGCCGAGCCAGGGCTTCCCAG
Exon23a 9650954 - 9650895
	GATCTGGAGACTCACCACTAGAAGACGATGGAGTCTGGTATTCACACTCTCTATATAAAG
Exon23b 9650894 - 9650747
	GTGAATTCTTTGCTTCTGTGCTGACAAGGACCCGCTGATGCCAGGAGATATTTCTTTAAAGCTTCGCAGAGCAGACTGTAATAAAGTGACCAGACAACAC
	ATTGGCTTTCTAATTGCCTGTCTAGGaaaataaatatttaaaaataaa
Exon24 9646690 - 9646499
	ACACTCCGTGGTGCTCTCCCATCAAGGTGAAGTATGGGGATGTGTACTGCAGGGCACCTCCTGGGGGATACTACAAAACAGCCTTGGGAACCAGATGTGA
	CATTCGCTGCCGAAAGGGCTATGAGCTTCATGGCTCTTCCCAGCTCATCTGCCAGTCAAACAAGCGCTGGTCAGATAAGGTCATCTGCAAAC
Exon25 9644727 - 9644551
	AGAAGCGATGTCCTACCCTTACCATGCCGGCAAATGGAGGGTTTAAGTGTGTCGATGGTGCCTACTTTAACTCTCGGTGTGAGTACTATTGTTCACCAGG
	ATATACATTGAAAGGGGAGCGAACAGTCACATGTATGGACAACAAGGCCTGGAGTGGCCGACCAGCCTCCTGTGTAG
Exon26 9636205 - 9636079
	ATCTGGAACCTCCTAGAATCAAGTGCCCAAGTGTGAAAGAACGTATAGCTGAGCCCAATAAGCTGACAGTCCGGGTGTCCTGGGAAAGCCCAGAGGGAAG
	AGATACAGCGGATGGGATTCTTACTGA
Exon27 9632926 - 9632805
	TGTTATTCTGAAAGGCCTTCCTCCGGGCTCAAATTTTCCAGAAGGAGACCACAAGATTGAGTACACAGTCTATGACAGAGCCGAGAACAAGGGAACTTGC
	AAGTTTCGAGTTAAAGTAAGAG
Exon28 9632157 - 9631978
	TCAGACGTTGTGGCAAGCTCAATGCCCCAGAAAATGGTTACATGAAGTGTTCCAGCGATGGTGACAATTATGGAGCCACCTGTGAATTCTCCTGTATTGG
	CGGCTATGAGCTTCAGGGTAGTCCTGCCCGAGTATGCCAATCCAATCTGGCTTGGTCCGGCACAGAGCCCAGCTGTGCAG
Exon29 9626875 - 9626742
	CGATGAATGTCAATGTTGGTGTCAGAACAGCAGCTGCACTTCTGGATCAGTTTTATGAGAAAAGGCGACTCCTCATTGTATCTACACCCACAGCTCGAAA
	CCTCCTCTACAGATTGCAGCTGGGAATGCTACAG
Exon30 9624922 - 9624801
	CAAGCACAGTGTGGCCTCGATCTCCGACATGTCACCGTGGTGGAGCTGGTAGGGGTCTTCCCAACTCTCATCGGCAGGATCAGAGCAAAGATTATGCCTC
	CAGCTCTAGCTCTACAGCTCAG
Exon31 9616226 - 9615103
	GCTGTTGCTTCGAATTCCTCTCTACTCCTTCAGCATGGTGGTAGTGGATAAGCATGGCATGGATAAAGAACGTTATGTCTCCTTAGTGACACCCATGGCT
	CTCTTCAACCTCATTGACACTTTCCCCCTGAGAAAAGAAGAGATGATCCTGCAGGCTGAGATGGGCCAGACTTGCAACGTCTGATGTGCTGTTACATTCA
	TGGTGGCTCCTCATCTCTTATTCTATACTACAGTGCCTGTGGGAAGGCCTTAAAATACCTTTGATGTACAGATTTTCATTTGTAATTTTAAAAGTCTATT
	TTATTATGTGCTTTCTTTGCTCTTAGACATTGGCACAAGGCTTTTTTTAAACTTTGAAATGTTAAAAAAATACGAATATATCTATTCTAACTCTCCTTTT
	AGTCCATTGTGGCTGATGAAATTAGAAGCTACAGCCACACTCATGCACTCAGAATATTCCTCAGTGTGAAACATGTTTTCCTTTTTCTTTTATTGTTTAT
	ATAAGTCTTTTGTTAATAAAATAATTTGAAGCAAACTTACTAAAACTCACCTTTAAAAAATACTCAAGCACCAGGCTTATTTGCTTGGCATGATCAGTAG
	TTTTAAAACTGTGATTCTTTGTTTATCTTAAGAAAGGGAAACTAGTCCtgtcaaggggtcaactgagctgagagagagagctacgttcccaagtgggaga
	atagcaaattgaaaatattcagacaaagctacatgatgttcatactgaaactgagtagactttttccccaatgtaatataaaaaaaactatttacaaatc
	acttccctcatatgaggtactataagtagtccagagaggtttaaagtatacaaggggattcacatggattccatgtaagtactggacgatttgatatcac
	aagtcgaatgactgttgggatcctggaaccaatcATTCCTGAGTTTGTGAATGAACAagcatgatgggccagtagggctgtattcttgactgcaccccac
	ccagagaggtgacaattcagaggttgtacatcaGACCCCTTTTCAGATATTTCTATTTTTAAATGATTGAGCCTAGAAAAAAAATCACACATTGGCATTT
	AATAAACAATTAGATTGTACTCCT
Exon32 9614883 - 9614258
	gggcatataaagtttgcatgtccaatgggcctctctttccattgatggccgactagggcatcttttgatacatatgcagctagagtcaagagctccgggg
	tactggttagttcataatgttgttccacccatagggttgcagatcccttcagctccttgggtattttctctagctcctccattgTTCTTAAACAAAATAG
	TGAAATTATAGAATGCTCAAGTTCCAACATATAGTGCCTGAAGACAGGCAGTAGGGTAAACAATATTCTCACAGAAGATTAGGCAGAGTAAACGCCAACC
	CTTGAATGGATTTGAATTCTATGTAGAAAACTGTATCATTTTCCTCTTTTACAGTAAAAACCACTCTTTAACTACTGCTTCATTTATATGTATCAGATTA
	AAGGAATACAACACAAATAGTGGATAAATGTCAAATGATAATGACCTTTACAAACTGCCCTGTGCCCATGGGATAATAGCAGGAAAGGAAGTTACCTGAC
	TTATTCAAAGCATTCTTTCTGGTCACTTTGTATCACTTTGACCCTCACCCAAAATACACAGATTATTTGAAGATGAATGGATACCCAGATGACCTGTTAT
	GTTTCAAAATAAAACACTCTATAAGA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
23+5dbEST_BY007969.1,dbEST_CJ114677.1,dbEST_CJ109899.1,dbEST_CJ124219.1,
34+5dbEST_BY007969.1,dbEST_CJ114677.1,dbEST_CJ109899.1,dbEST_CJ124219.1,
24+4dbEST_CJ058370.1,ENSMUST00000115534,REF_NM_001177952.1,GB_AK138977.1,
14+91dbEST_AA270124.1,dbEST_BB645906.1,dbEST_BB649134.1,dbEST_BB631926.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,REF_NM_001177953.1,REF_NM_001177954.1,GB_AF044677.1,GB_AJ238396.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,GB_AK017192.1,GB_AK038652.1,GB_AK081631.1,
45+95dbEST_AA270124.1,dbEST_BB645906.1,dbEST_BB649134.1,dbEST_BB631926.1,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,REF_NM_001177953.1,REF_NM_001177954.1,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,GB_AK017192.1,GB_AK038652.1,GB_AK081631.1,
56+77dbEST_AA270124.1,dbEST_BB645906.1,dbEST_BB649134.1,dbEST_BB631926.1,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,REF_NM_001177953.1,REF_NM_001177954.1,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,GB_AK017192.1,GB_AK038652.1,GB_AK081631.1,
67+65dbEST_BB645906.1,dbEST_BB649134.1,dbEST_BB631926.1,dbEST_BG295591.1,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,REF_NM_001177953.1,REF_NM_001177954.1,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,GB_AK017192.1,GB_AK038652.1,GB_AK081631.1,
78+42dbEST_AV161514.1,dbEST_AV160817.1,dbEST_BB649134.1,dbEST_BY358291.1,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,REF_NM_001177953.1,REF_NM_001177954.1,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,GB_AK017192.1,GB_AK038652.1,GB_AK081631.1,
89+23dbEST_CN538549.1,ENSMUST00000072393,ENSMUST00000044598,ENSMUST00000073392,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,REF_NM_001177953.1,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,GB_AK017192.1,GB_AK038652.1,
910+24dbEST_CF749261.1,dbEST_CN538549.1,ENSMUST00000072393,ENSMUST00000044598,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,REF_NM_001177953.1,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,GB_AK017192.1,GB_AK038652.1,
1011+24dbEST_CF749261.1,dbEST_CN538549.1,ENSMUST00000072393,ENSMUST00000044598,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,REF_NM_001177953.1,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,GB_AK017192.1,GB_AK038652.1,
1112+23dbEST_CF749261.1,ENSMUST00000072393,ENSMUST00000044598,ENSMUST00000073392,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,REF_NM_001177953.1,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,GB_AK017192.1,GB_AK038652.1,
1213+23dbEST_CF749261.1,ENSMUST00000072393,ENSMUST00000044598,ENSMUST00000073392,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,REF_NM_001177953.1,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,GB_AK017192.1,GB_AK038652.1,
1314+22ENSMUST00000072393,ENSMUST00000044598,ENSMUST00000073392,ENSMUST00000115534,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,REF_NM_001177953.1,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,GB_AK017192.1,GB_AK038652.1,
1415+20dbEST_BB333763.2,ENSMUST00000072393,ENSMUST00000044598,ENSMUST00000073392,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,GB_AK017192.1,
1516+7ENSMUST00000044598,ENSMUST00000115532,ENSMUST00000115531,REF_NM_001177950.1,REF_NM_001177951.1,GB_AJ238396.1,GB_AK029864.1,
1517+14dbEST_BB333763.2,dbEST_BB263889.1,ENSMUST00000072393,ENSMUST00000073392,REF_NM_001177952.1,REF_NM_011285.2,GB_AF044677.1,GB_AK138977.1,GB_AK136298.1,GB_BC012661.1,GB_AK017192.1,
1617+10dbEST_AV271886.2,dbEST_BU937149.1,dbEST_BU961634.1,ENSMUST00000044598,REF_NM_001177950.1,REF_NM_001177951.1,GB_AJ238396.1,GB_AK029864.1,
1718+27dbEST_AA529689.1,dbEST_AI551907.1,dbEST_AV476049.1,dbEST_AV271886.2,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,
1819+26dbEST_AA529689.1,dbEST_AI551907.1,dbEST_AV474289.1,dbEST_AV476049.1,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,REF_NM_001177951.1,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,GB_AK136298.1,GB_AK029864.1,GB_BC012661.1,
1920+4dbEST_AV271886.2,ENSMUST00000115532,REF_NM_001177951.1,GB_AK029864.1,
1921a+14dbEST_AV474289.1,dbEST_AV476049.1,dbEST_BU937149.1,dbEST_BU961634.1,REF_NM_001177952.1,REF_NM_001177950.1,REF_NM_011285.2,GB_AF044677.1,GB_AJ238396.1,GB_AK138977.1,
1921b+2ENSMUST00000115533,GB_AK136298.1,
1823a+2dbEST_BB333763.2,ENSMUST00000072393,
2223a+25dbEST_AA839400.1,dbEST_AI553615.1,dbEST_AI465834.1,dbEST_BB626778.1,REF_NM_016911.4,GB_AK034696.1,GB_BC022572.1,GB_AB028049.1,GB_BC027630.1,
23a24+20dbEST_BB626778.1,dbEST_BB618249.1,dbEST_BB627973.1,dbEST_BE290137.1,REF_NM_016911.4,GB_AK034696.1,GB_BC022572.1,GB_AB028049.1,
2224+10dbEST_BE917351.1,dbEST_BE916810.1,dbEST_BE289482.1,dbEST_BE290521.1,GB_AK159662.1,
2225+2ENSMUST00000115543,GB_AB028050.1,
2425+25dbEST_BB611477.1,dbEST_BB626778.1,dbEST_BB618249.1,dbEST_BB627973.1,REF_NM_016911.4,GB_AK034696.1,GB_BC022572.1,GB_AK159662.1,GB_AB028049.1,
2526+21dbEST_AW241105.1,dbEST_BB611477.1,dbEST_BE309314.1,dbEST_BE917351.1,REF_NM_016911.4,GB_AK034696.1,GB_BC022572.1,GB_AK159662.1,GB_AB028049.1,GB_AB028050.1,
2627+19dbEST_AW241105.1,dbEST_BB611477.1,dbEST_BE309314.1,dbEST_BE917351.1,REF_NM_016911.4,GB_AK034696.1,GB_BC022572.1,GB_AK159662.1,GB_AB028049.1,GB_AB028050.1,
2728+16dbEST_BB611477.1,dbEST_BE309314.1,dbEST_BF121684.1,dbEST_BF124634.1,REF_NM_016911.4,GB_AK034696.1,GB_BC022572.1,GB_AK159662.1,GB_AB028049.1,GB_AB028050.1,
2829+17dbEST_BE309314.1,dbEST_BF121684.1,dbEST_BF124634.1,dbEST_BI111915.1,REF_NM_016911.4,GB_AK034696.1,GB_BC022572.1,GB_AK159662.1,GB_AB028049.1,GB_AB028050.1,
2930+17dbEST_AA175095.1,dbEST_AI592494.1,dbEST_BI111915.1,dbEST_BI454542.1,REF_NM_016911.4,GB_AK034696.1,GB_BC022572.1,GB_AK159662.1,GB_AB028049.1,GB_AB028050.1,
3031+17dbEST_AA175095.1,dbEST_AI449065.1,dbEST_AI592494.1,dbEST_BI111915.1,REF_NM_016911.4,GB_AK034696.1,GB_BC022572.1,GB_AK159662.1,GB_AB028049.1,GB_AB028050.1,
3132-0