NIA Mouse Gene Index (mm92)

Exon structure for U060428

chr16 -

Exon1 16864078 - 16863789
	CTGGAATAGCTTTTGGCCACCAGAGGAGGAACAATCCTTTTGCCGGGAGATCTACACTGCAAGTGAGGCTAGAGTTGACTTTGGACTTGAGGGTCAATGA
	AGCTCAGAGTAGGACAGACTCTGGGCACTATCCCCAGGCAGTGTGAAGTTCTCCTCCTGCTGCTGCTGTTGGGTCTAGTGGATGGTGTCCACCACATACT
	TTCCCCAAGCTCAGCAGAAAGGAGCAGAGCTGTGGGCCCTGGAGCTTCAGTGGGAAGCAACAGGCCTAGCCTATGGGCCCTTCCCGGCAG
Exon2 16862637 - 16862522
	GCTCCTGTTCCAGATCATCCCACGGGGAGCAGGTCCCAGGTGCTCGCCCCATAGGCTTCCATCTAAGCCCCAGTTTTGGTATGTCTTTGGTGGTGGGACC
	CAGCTCACAATCCTAG
Exon3 16861227 - 16860764
	GTCAGCCCAAGTCTGACCCCTTGGTCACTCTGTTCCTGCCTTCCTTAAAGAATCTTCAGGCCAACAAGGCCACACTAGTGTGTTTGGTGAGCGAATTCTA
	CCCAGGTACTTTGGTGGTGGACTGGAAGGTAGATGGGGTCCCTGTCACTCAGGGTGTAGAGACAACCCAACCCTCCAAACAGACCAACAACAAATACATG
	GTCAGCAGCTACCTGACACTGATATCTGACCAGTGGATGCCTCACAGTAGATACAGCTGCCGGGTCACTCATGAAGGAAACACTGTGGAGAAGAGTGTGT
	CACCTGCTGAGTGTTCTTAGACCACAATCCTCCCTGAAGCCTCAGGGGCCTGGATCTGAAGTGCCAGAAAAAGTTGTTTTTTGTTTTGTTTTTTGTTTTT
	TTTCCCATTAACCATCTCACTGTCTTTCCTGTGCCTAATACTCAATAAATATCTTACCACCAAC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+9dbEST_BY722700.1,dbEST_BB629334.1,dbEST_BY722747.1,ENSMUST00000124890,REF_NM_001190325.1,GB_AK137514.1,GB_AK137552.1,
23+4ENSMUST00000124890,ENSMUST00000100136,REF_NM_001190325.1,GB_M30387.1,