NIA Mouse Gene Index (mm92)

Exon structure for U078480

chr6 -

Exon1 85324628 - 85324092
	CCAGCCCGCAGCTGCGGCGGTCGGTGCGCTGCAGGCGGCGCGGGGGAGCCGGCTCCTGACAGCATCCCGCGGCTGCCACGTCTGTCACTCTGTCCCAGGG
	TCCGCCATGGCTCTGGTGCGGGACCCTGAGCCGGCGGCCGGATCCTCCCGCTGGCTGCCCACGCATGTCCAGGTGACCGTGCTGCGGGCCAGCGGGTTGA
	GGGGCAAGAGCTCGGGCGCCGGCAGCACCAGCGACGCGTACACGGTGATCCAGGTGGGCCGAGAGAAGTACAGCACCTCGGTAGTGGAGAAGACGCAAGG
	CTGCCCGGAATGGTGCGAAGAGTGTTCGTTCGAGCTACCGCCTGGAGCCCTGGACGGCCTGCTGCGGGCACAGGAGGCAGATGCGGGCCCTGCGCCCTGG
	GCCTCCGGCCCCAACGCCGCCTGCGAGCTCGTGCTCACCACCATGCATCGCTCACTCATCGGCGTGGACAAGTTTCTGGGCCGGGCAACCGTAGCTCTGG
	ACGAGGTCTTCCGCGCAGGCCGCGCCCAGCACACGCA
Exon2 85300312 - 85300264
	aggctgatctcaagctttcagtgatcctcctgcctcagcgtccccagtg
Exon3 85298985 - 85298549
	GTGGTACAGGCTTCACTCCAAGCCAGGCAAGAAGGAGAAGGAGCGCGGTGAGATCCAGGTGACCATCCAGTTCACACGGAACAACCTGAGCGCCAGCATG
	TTTGATCTTTCCATGAAGGACAAGCCACGGTCTCCCTTCAGCAAGCTCAAGGACAGAGTGAAGGGCAAGAAGAAGTATGATCTCGAATCTGCCTCAGCGA
	TTCTTCCAAGCAGCGCCCTGGAGGATCCTGAGTTAGGCAGCCTGGGCAAGATGGGCAAAGCCAAAGGTTTCTTCCTCCGAAACAAGCTACGCAAGTCCTC
	GCTCACACAGTCTAACACCTCTCTGGGCTCTGACAGCACCTTGTCTTCCACTAGTGGCAGCCTGGTCTACCAGGGACCCGGGGCGGAGCTCCTCACCCGC
	TCACCAAGCCACAGCAGCTGGCTGTCCACTGAAGGGG
Exon4 85298449 - 85297774
	GTAGGGACTCTATACAGTCCCCCAAGCTGCTCACCCACAAGAGGACATACAGTGATGAGGCCAGCCAGCTTCGAGCAGCTCCTCCCCGGGCCCTTCTTGA
	GCTCCAAGGCCACCTTGATGGTGCCTCCCGCTCTTCCCTCTGCGTCAATGGGAGCCATGTGTACAATGAGGAACCTCAGCCCCCCTTACGGCACCGCAGC
	TCCATCTCAGGCCCCTTTCCACCTTCAAGCTCCTTACACAGTGTCCCACCTCGGTCCTCTGAGGAGGGGTCTCGGTCCTCGGATGATTCTTGGGGCAGAG
	GCAGCCATGGCACCAGCAGCTCAGAGGCAGTGCCTGGACAGGAGGAGCTGAGCAAGCAGGCCAAAGGGGCCAGTTGCTCTGGAGAGGAGGAGGGGGCCCG
	GTTACCCGAGGGGAAGCCAGTCCAGGTTGCCACCCCCATGGTGGCCTCCTCTGAGGCTGTGGCAGCAGAAAAGGATCGGAAGCCCCGAATGGGGCTCTTC
	CATCACCACCACCACCAAGGGCTGAGTCGGAGTGAGCAGGGGCGCCGTGGCTCAGTCGGGGAGAAGGGGAGTCCGTCCCTGGGAGCCTCCCCCCACCATT
	CATCCACCGGGGAGGAAAAGGCCAAGAGTAGCTGGTTTGGCCTGAGAGAATCCAAGGAGCCAACTCAGAAGCCCAG
Exon5a 85292355 - 85291634
	CCTGGACGTGTCTCCTCAGGTAGAATCTGACCCAGCTGCTCCTCACCCCTGCTCCCCCCAGGCTCTGGCCCCCCCTCCTGCTCCCGCTGCTGCTCCCATG
	CTAAGCACTAACCTTTTTGCAGTCACCTCCCCTGCCGCTGCCACTGCCGCTGCTGCCACCATTGTCCTTGAAGCCACCCCATCCGGATTCTTGGGGGTCA
	CCAACCCGTTCCTCAACTCCTTGCAGAGCAACCCCTTCTTCGAGGATCTCAAAGCCGACATAGCACTAAATTCTCCTTCACCTGCTCCCTCTCTCCCCAG
	TGCCTCGAGGGCCAGCCTGGCCCCCCTGGCCTCCCCTGGGAAAGCCCTGCCTGAGTGGGACGACACCTTCAACATCTTTGCTGCTGGCAGGCTGCAGCAA
	GAGGCCGGGAGTGGGATCCTGGCCCCTGCAGGAATGGGGCTGGAGGAGGATGGGCTGCAAGACCCAGGCCCTAGGACCATGGCAGTGAAAGCGACAGAGC
	CCCAGGGAGAGCCTGGGAGAGGAAGAAGAGGAAGCAACATATGGCTAGAGCCCAAGGTTTCTGTGGACTCAGAACTGGACCAGCCAAGCACAAGTATGTC
	TGACCCAGGACCCTTTGGGTCTTCAGGGAGTGGTCCATCCTCCAGGGCATCCCAGTTGCACCTGCAAGCCTCAGCCTCAACACCAGACCGGGAGCTTCCT
	GCCTCAGAAGGGGGAGCGGGGC
Exon5b 85291633 - 85291046
	AGAGTCCAGCAGATAGTGGGGCATCTCTGTTCAGCTCCCCAGAAGTTCTCAGTGTGTGGGAGAGATTTCCTGGTTCAGATGACACTCCTGGAGGCCGAGA
	TGAGGAGGCCCCCCAAGATGGAAGCCAGCTTTTCCAGGAGCTGAACACAGTGGAGGATTCCTGGCCTTGGGATGTGATCACCATTTCTCCTACAGCAGAG
	GTCGCTTCACCTGTCATGAAGGGAGAATCCGACGGGGTACTTTCTTCCCAGGTGCAGCCTGAATCTCCAGATACTGTGCCCCCCATGGGGAGCGAAGGGC
	TCCCAGCATTGCTGGAGCCAGAGCCAGAGCAGGGATTGGATGAGGGGCCATGGCTTGGCCCTCCACCTCCCAAGCCACCACGCCTCTTCACACCCACCAA
	TTCTCaggtggaggaggaggacaaagaggaggaagagaaTGCTACAGGGCGGCAAAGTAGCAGGGGACCAGGGGTAGAAAAAGACAGCACCCCCCGTGCA
	TTGGCCATTGGTCCCCAAGAGTCTAAGGAGGAATGGGTAAATCCAGAGTTGGAGAAATTGCATAGACTGCCCTCTGGAACCCTGATAG
Exon5c 85291045 - 85290492
	GTAAGCCAGAACTTGAAGACCCAGTAGGAGAAACTAGTAGCCCTGTGTTTGGGGACTGTCCACCTAGGCCCACCAGCTGCCCTGAGGGGCCTGTCCCCAG
	ACCCCATAACTCAATCAGCTCCACTCTGCTGAGTCAGAAGGTCTTGGGGACCTCAGAGACAGAGGAGGGCTTTGAAACCAAGAGCCAGGAGCTAGCCAAA
	GAGGGGTTTGGGCCTCTCTCAGTCCCCTCCCAGCAGTCAAGTATGCGGGCCAaggaagaggaggagggggaggaagaggaggaagagggagaggaggagg
	aggCATTGGAGACCTCCAATTCCTTCTTATGTCAGGAAAGCCAAGATCCCCCCAGCTTCCCATCCATATCACCACCAGGGTCAAGGGGATCCTCTATTCA
	CTCTGGTCCAGAAGAGTTGCCCACACCCCCAGAACCTGCCTTCCCACCTCCCCCTCTCCCACCCTGGGCCAGCCACCGCCACGGCGTGCCAGGCCCTCCA
	TGCCCTCCCCTGCCTATAGCCTGGCCCTTGACCTCTTCTTCCTCACCTCCCGAG
Exon5d 85290491 - 85290337
	GAGTCAGCTTCACCCCTCGGTCCCCCTGAGCTCTCCCCCACTGGGGGCTCCCCTACATCATATGGGGAAGACCATGCTGCAGCCACCCCAGCCTCCCCGC
	TTGTGCTTCTGCCCCTGGAGACACGACCAGCTGAGGAGCCCCAGCCCAGCGGCAG
Exon6 85287664 - 85287475
	TCCCCACCCTGTGAAACCCCTTACTGCTGCCCCTGTGGAGGCTAGCCCCGACAGGAAACAGCCCCGTACCAGCCTGAGCACAGCCCTGAGTAGCGGACTG
	GAGAGGCTCAAAACTGTCACATCTGGTGGCATCCAGTCTGTGCTTCCAGCGTCCCAGCTTGGCTCAAGTGTGGACACCAAGAGGCCAAAG
Exon7 85287220 - 85284956
	GATTCTGCTGTGCTGGACCAGTCGGCCAAGTACTATCACCTGACTCATGATGAGCTCATTGGCCTGCTCCTGCAGCGTGAGCGTGAGCTGAGCCAGAGAG
	ACGAGCATGTGCAAGAACTGGAGAGCTACATTGACCGGCTGCTGGTGCGGATCATGGAGACCTCGCCCACACTGCTGCAAATCTCCCCTGGCCCCCCCAA
	GTAGCCCTTCACGCCATCCCTGGAGGGATGGTGAGGACCTGTGTAGTGCCCGCCACTGACTGCTCTCACCTGAGTAGGGCAAGCCTGCTCTCATGGTGAC
	TCTCTGCACCCCTCCCCATCCTGCCTCTGCTCTGGCTGCTGGAAGGGGCTCTTTGAACTCCCACTGGAGCCTTGGGTCTTCCCTACCTGACCATTCTCAC
	ACGCGAGGTTATGGGGCTCCCCAGAGAATTGCAACAAGGTTGTTAGCTGTCAAGATGGAGCAGGAGTGAGCTCTGGGTTCTGGGGTGAGCTGAATTATCT
	AAGGCAACACTGTTGACAGCACAGCTCACCCCATGAGGCTGGTCATTTGTTTCTCCTCTTGACCAACTCTTCATCTCCATTGCCTTCTGGCACCTGGAGG
	GTCTCCTAGGCCACTGGGACAGGGATGGGAACTAAGCTGCTTGCTTTTCTGTGCACTGTAGACAACCAGGGCACCTACACTTCAGCCTTGTGCCTATACC
	CTAAGAGCAAGGAGCCTGTGTGTTTTCGTCTTGTCTCTCTGTCTAGAGCATGTACACAGggtggtggtggtggtggggggtggtggtggtggtggtggtg
	gtATGTGCCTATTCCTCAGCTGCCCCCTGCCCCTCTTCAGACCCTCCCACTCCATGTCCCAGTAGTGGTGGGAGGTGGGGTGGGCACAGAGGGAATGACT
	TCTTTCTCCTGCAGTCCTCCCTACCTCCCTAACATGAAACCCTCCAGGTTGGGGTTTGGGGCTGCTCATGTTTTGTGGACCAGGCCTCCATTCATGTCTG
	TTAACACTCGTCAGATGCCAAAACTGTGCTGCTGTGGGCTCAGAACATTTGGAAACCAATTAAACGTGCCTTTTGTGGGTGAGGACAAGAGCCTCTGGAT
	GTAGATGTCTCTCTGGCCATGGTGTCCCCTCCCTCCTGTTGAGCACGTGAAAACGGCTGTGAGGGTCCTGAAAGGGGGCTGTGGACCACGCTGTTTACTA
	CCCCGAGAAGTACCTCAGCTAAGGCTCTGGCCAACCTGCTTTGGAGGTGTCCTAAGCCGCCTTCCCACTTCCTGGTCCTCCCTTGACCCTTATTTGGAGC
	ATCCTGGTAAAAAAATCTAGTGCACAGTAGGTCTGGGGCTATCCTGCACCTTACTGTGTCTGACCTTGGGTCCCAGTTATGCTGGACCAGTGGGTTTGTC
	TGGAAGCAGGAGGCTTCATTCTGCTTTAGGAGACACCTGAGCTTAGGAAAATGCCCGTGGCTCTCCAGCTGTTCTGTCCTTGTTGTACAGTCCCTCCTGC
	TCACCAATCCCTCCTGTCTTGCCTGGCTTGGCTGAAGTGCATTCAAGTGAAGTCAGGTATCTGCTCTGTGGTCCAGCTTCTAGCTTGCTTGTGAATACTG
	CCAGTCTCCCTGGCATCCTCGGGGGTCCTTGGTGGCTGTGCATTACAAAAGGTATGAGTGAAGGAGGTGAGATGCTGACAAAAGATTCTTTGGGCCCAGT
	GGAGAAGCAGTAACGTCTTTCCAGCTGTCTCTTAAAGACAGGGTCATGGGTTCACTCAGAACACCTCAGGAGAATATTCTCTGTGGATGACGTCAGTCTT
	CTGCCAGCATAGAGCAGATGAACCACAATGGGGTCCACCACTGTGCAGTTACCAACTATAGGTCAACTCAGAGATGAGAAAATAGCCACCAGTTCCCAGA
	GTTTGGGGGTAGGGTCAGTCCTTGGGTGTTGGAGGTGTCTTTTGAGGAACTGAGTCCCTCTTCTAGGTCTTCCTCTGGGCTTTAATTAGTCCCAGCCCTT
	CTCTCATCTTTCATCCATCCTTGCTGTTTGGCTTCTCTACATGGCCAGGGCAGGGGTGTCCTGCAGAGAGGTCCTGAACTGAGGCCAGGGTTTTGTTCAT
	TGTCTGATCCTTACCACATACTGCAGAGTGCAGCCAGACAGGCAGCAAGCAGGCACAGCTCTGCTCTGCCCTTTGTCCTCCTAGTTGAAACTCCTGTCTA
	TAAAGAGCTTGTTCTTCATGTTTTGAGCACTTTATGAAGAATAAAAAGATCACGTACCGCAGCCA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
23+3dbEST_BY734887.1,ENSMUST00000169724,GB_AK145061.1,
13+14dbEST_BI689260.1,dbEST_BY093096.1,dbEST_BY747628.1,ENSMUST00000089579,REF_NM_001003955.2,REF_NM_177466.4,GB_BC044833.1,GB_BC051063.1,GB_AK154922.1,GB_AK129230.1,GB_BC141380.1,GB_BC172698.1,GB_BC156559.1,
34+17dbEST_CB249497.1,dbEST_CB722643.1,dbEST_BY734887.1,ENSMUST00000089579,REF_NM_001003955.2,REF_NM_177466.4,GB_BC044833.1,GB_BC051063.1,GB_AK154922.1,GB_AK129230.1,GB_BC141380.1,GB_AK145061.1,GB_BC172698.1,GB_BC156559.1,GB_AK218808.1,
45a+6ENSMUST00000089579,REF_NM_001003955.2,GB_AK154922.1,GB_AK129230.1,GB_BC172698.1,GB_BC156559.1,
5b5d+1dbEST_BQ745206.1,
5d6+10dbEST_BM963784.1,dbEST_AI425140.1,dbEST_AA655073.1,dbEST_BQ745206.1,REF_NM_001003955.2,GB_AK154922.1,GB_AK129230.1,GB_BC172698.1,GB_BC156559.1,
46+17dbEST_CK790083.1,dbEST_BE376146.1,dbEST_BF099738.1,dbEST_BF686861.1,REF_NM_177466.4,GB_BC044833.1,GB_BC051063.1,GB_BC141380.1,GB_BC026473.1,GB_AK145061.1,
67+28dbEST_BU613063.1,dbEST_BM949273.1,dbEST_BM963784.1,dbEST_BI156284.1,REF_NM_001003955.2,REF_NM_177466.4,GB_BC044833.1,GB_BC051063.1,GB_AK154922.1,GB_AK129230.1,GB_BC141380.1,GB_BC026473.1,GB_AK145061.1,GB_BC172698.1,GB_BC156559.1,