NIA Mouse Gene Index (mm92)

Exon structure for U080390

chr9 +

Exon1 40682210 - 40682522
	TGCTTCCTGCACTTTGTCCGGGCCCTCGCCCTGTGACAGGCGCTCTGCAAGATGAATCTCAACTTCACTTCCCCTCTTCATCCAGCATCTTCTCAGAGGC
	CCACGTCGTTTTTCATCGAGGACATTCTGCTACACAAGCCCAAGCCGTTGAGGGAAGTGGCCCCTGACCACTTTGCCAGCTCTCTGGCCTCTAGGGTGCC
	TTTGCTAGACTATGGCTACCCCCTTATGCCCACACCCACCCTCCTCACCCCTCACGCTCATCATCCTCTGCATAAGGGAGATCACCACCATCCTTATTTC
	CTGACCACCTCAG
Exon2 40684377 - 40684573
	GGATGCCGGTCCCGGCGCTGTTCCCGCACCCGCAGCACGCGGAGTTGCCCGGGAAGCACTGCCGCCGCCGCAAAGCTCGCACGGTGTTTTCTGACTCGCA
	GCTCTCCGGCCTGGAGAAAAGGTTCGAAATCCAGCGCTACCTGTCGACGCCAGAGCGTGTGGAGCTGGCCACTGCCCTCAGCCTCTCAGAGACTCAG
Exon3 40685691 - 40686055
	GTGAAAACGTGGTTCCAGAACCGGCGGATGAAGCATAAAAAGCAGCTGAGGAAAAGCCAAGACGAACCGAAAGCGGCAGACGGGCCGGAGAGCCCCGAAG
	GCAGCCCTCGTGCTCCCGAGGGCGCGCCCGCCGACGCTCGGCTGAGCCTGCCCGCCGGTGCCTTCGTGCTTACTGAGCCCGAGGACGAAGTGGACATTGG
	GGATGAAGGCGAGCTCAGCTCAGGGCCGCATGTGCTCTGAGTGGCCAGGCTGGGAAGGGAGACCCGGGCGAGGAGGCCGCGGGGCCAGACCGGGTTCTTC
	CCGGGTGGGAAGACTCGCGGAGACTCCAGACTGCTCCTGCGACCTGGGCTGGAAGAAAGAAAGGC

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+5ENSMUST00000067375,REF_NM_178245.3,GB_AY233396.1,GB_BC104386.1,GB_BC104387.1,
23+5ENSMUST00000067375,REF_NM_178245.3,GB_AY233396.1,GB_BC104386.1,GB_BC104387.1,