NIA Mouse Gene Index (mm92)

Exon structure for U084977

chr7 -

Exon1 29747359 - 29747038
	GGCAGCGCAGTGCGCAGGCGCGGCAAGTGAACTGCGCAGGCGTCAGTCTTGGGCGGGCTGAAAGCAGCTGAAGCGGCGGCCGAGTCGGAGCCTCCGGCAC
	AGGGGCGGGAGCTGAGGCGGTAGCGGACCGGCTGGCGGGCTAGCGAAAGGCGGCGGAATGGTGGACTACCACGCAGCGAACCAGGCGTACCAGTACGGCC
	CGAACAGCGGCGGCGGCAATGGCGCGGGTGGCGGCGGAAGCATGGGCGACTACATGGCCCAGGAGGATGACTGGGACCGGGACCTGCTGTTGGACCCGGC
	CTGGGAGAAGCAGCAGCGCAAG
Exon2 29735082 - 29734651
	tctatatagtgtagccctggctgttcttgacctagctcCCCACCCTGCGGATTCTGGGGTTCAGGTCATTTAACAATCACCCTGATTTACCCATCTTTCA
	AGTCCAGCTCTTCTAGGCCCTCTCCTCTGTAAACCCCTCTCCTACCCACTCTTTATCTCTTCCTGTTTCCTCTGGTCAGGTGCATCTAGGGCTACTCTAG
	TTCAAAGAAGGAGGTAGACTTTTAGGTGATTACATCTCAGCATTTCTGCTTTTTGTATCCTGTTGGAAGCCAGTGCAGGACAATGTAGTCTCACTGGACC
	CATGGTTGTTTGAAGACTCAGCTTGTCAGACTAGTTGTGTGGCTTTTACTCCCTGGAGGGAGGAGCAGAGAGAGAGCTTGGGGCTCTCAGTGAACACTCT
	TGCTTTTGTGCACACTATATCAGAGGGAGAAG
Exon3 29704240 - 29704175
	tggaggccaaaagactaggaggccatccttgaatccagccggggctacgtgagaacctgtcttaaG
Exon4 29704087 - 29703973
	ACCTTCACAGCCTGGTGCAACTCTCATCTTCGGAAGGCTGGCACTCAGATCGAGAATATCGATGAGGACTTCAGGGATGGGCTCAAACTTATGCTTCTGT
	TGGAGGTCATTTCAG
Exon5 29703810 - 29703691
	GGGAGCGTTTGCCTAAGCCAGAGCGGGGGAAGATGCGAGTGCACAAGATCAACAATGTAAACAAAGCCCTGGACTTCATCGCCAGCAAGGGAGTCAAGCT
	GGTGTCCATCGGGGCAGAAG
Exon6 29701265 - 29701179
	AGATTGTGGATGGCAATGCAAAGATGACCCTGGGAATGATCTGGACCATCATCCTCAGATTTGCCATCCAGGACATCTCTGTGGAAG
Exon7 29700319 - 29700232
	AGACCTCTGCTAAGGAAGGACTCCTCCTCTGGTGCCAGAGAAAGACAGCCCCATATAAAAACGTCAACGTCCAGAACTTCCATATCAG
Exon8 29698475 - 29698397
	CTGGAAGGACGGGCTGGCCTTCAATGCACTCATCCACCGGCACAGGCCTGAGCTGATTGAGTATGACAAGCTGCGGAAG
Exon9 29697340 - 29697259
	GATGATCCAGTCACCAACCTAAACAATGCATTTGAAGTGGCTGAGAAATACCTCGATATCCCCAAGATGTTGGATGCTGAGG
Exon10 29696594 - 29696509
	ACATCGTGAACACAGCCCGGCCCGACGAGAAGGCCATAATGACATATGTGTCCAGCTTCTACCATGCCTTTTCAGGAGCGCAGAAG
Exon11 29695007 - 29694922
	ATATTGTAGGCACTCTGAGGCCAGATGAGAAGGCCATCATGACTTACGTGTCCTGCTTCTACCACGCCTTCTCGGGGGCCCAGAAG
Exon12 29692705 - 29692565
	GGGAAAGCACACTGGACCTGGAGCCAACTCCCGAGCCTCTGTTTCCTCCTCATCACCCTGTAGACCCTCTTCACTATTTCTGTTCCTGTTCTGTTGCCGT
	TCCAACTCTTCTTGGATCTTTTTTTTTGTGCTGCCCGAAAG
Exon13 29692404 - 29692317
	AGCCTCACCTCCGAGTAGGGGCCAGAATGGGCAGAACATGCACCACATACACTGAGACTATAGTACCGCATCCCTCACCACCCTTCCA
Exon14 29692083 - 29691991
	GCTGAGACCGCTGCCAACCGGATCTGCAAGGTGCTGGCTGTGAACCAGGAAAATGAGCACCTGATGGAAGACTATGAACGCCTGGCCAGTGAT
Exon15 29690474 - 29690244
	CTTCTAGAGTGGATTCGGCGCACCATCCCCTGGCTGGAGGACCGGGTGCCTCAGAAGACCATCCAGGAAATGCAGCAGAAGCTGGAGGACTTCCGAGACT
	ATAGGCGTGTGCACAAGCCGCCCAAGGTGCAGGAGAAGTGTCAGCTGGAGATCAACTTCAACACACTGCAGACCAAGCTGCGGCTCAGCAACCGGCCTGC
	CTTCATGCCCTCCGAGGGCAGGATGGTCTCC
Exon16 29689707 - 29689560
	GACATCAACAATGGATGGCAGCACCTGGAGCAGGCTGAGAAGGGCTATGAAGAATGGCTGCTGAATGAAATCCGTAGGCTGGAACGGCTTGACCACCTGG
	CAGAGAAGTTCCGGCAGAAGGCTTCCATCCACGAGGCCTGGACTGATG
Exon17 29687046 - 29686896
	GGAAGGAGGCCATGCTGAAGCAACGGGACTACGAGACAGCCACCCTGTCAGACATCAAAGCTCTGATCCGAAAACATGAGGCCTTTGAAAGTGACCTGGC
	TGCACACCAGGACCGAGTGGAGCAGATTGCTGCAATTGCTCAGGAGCTCAA
Exon18 29683747 - 29683639
	CGAGCTGGACTACTATGACTCCCACAACGTCAACACACGGTGCCAGAAGATCTGCGACCAGTGGGATAACCTGGGCTCTCTGACACACAGTCGCAGGGAA
	GCCTTGGAG
Exon19 29683498 - 29683358
	AAAACAGAGAAACAGCTAGAGACCATCGACCAGCTACATTTGGAGTATGCCAAGCGGGCTGCACCCTTCAACAACTGGATGGAGAGTGCCATGGAGGACC
	TGCAGGACATGTTCATCGTCCACACCATCGAGGAGATCGAG
Exon20 29683270 - 29683088
	GGCCTGATCTCAGCCCATGACCAGTTCAAGTCCACCCTGCCAGATGCTGACAGGGAGCGTGAGGCCATCCTGGCCATCCACAAGGAGGCCCAGAGGATCG
	CTGAGAGCAATCACATCAAGCTGTCGGGCAGCAATCCCTACACCACTGTTACCCCCCAGATCATCAACTCCAAGTGGGAGAAG
Exon21 29683002 - 29682868
	GTGCAGCAGCTGGTGCCAAAGAGGGACCATGCACTCCTGGAGGAGCAGAGCAAGCAGCAATCCAATGAGCACCTTCGCCGACAGTTCGCCAGCCAAGCCA
	ATATGGTGGGGCCGTGGATCCAGACCAAGATGGAG
Exon22 29682074 - 29681895
	GAGATCGGGCGCATCTCCATTGAGATGAACGGGACTCTGGAAGACCAGCTGAGCCACCTGAAGCAGTACGAGCGCAGCATCGTGGACTACAAGCCCAGCC
	TGGACCTGCTGGAGCAGCAGCACCAGCTCATCCAGGAGGCCCTCATCTTCGACAACAAGCACACCAACTACACAATGGAG
Exon23 29681254 - 29681108
	CATATCCGTGTGGGCTGGGAGCAGCTGCTCACGACCATTGCCCGCACCATCAATGAGGTGGAAAACCAGATCCTCACCCGAGATGCCAAGGGTATCAGCC
	AGGAGCAGATGCAGGAGTTCCGGGCATCCTTCAACCATTTTGACAAG
Exon24 29680531 - 29680451
	GACCATGGCGGGGCACTGGGGCCTGAGGAATTCAAGGCCTGCCTCATCAGCCTGGGCTATGACGTGGAGAATGACCGGCAG
Exon25 29680205 - 29680139
	AAGCAGACAGGCAGCATGGACTCAGATGACTTCAGGGCCCTGCTTATCTCCACAGGATACAGCCTGG
Exon26 29679678 - 29679520
	GGTGATGCTGAGTTCAACCGGATCATGAGTGTGGTTGATCCCAACCATAGTGGCCTCGTGACCTTCCAAGCCTTCATTGACTTCATGTCAAGGGAGACCA
	CAGACACAGACACAGCTGATCAGGTCATCGCCTCCTTCAAGGTCCTGGCAGGAGACAAG
Exon27a 29679406 - 29679240
	AACTTCATCACTGCTGAGGAACTGCGGAGAGAGCTGCCCCCCGACCAGGCCGAGTACTGCATCGCCCGCATGGCACCCTACCAGGGGCCTGATGCTGCTC
	CTGGCGCCCTTGACTACAAGTCCTTCTCCACAGCCCTCTATGGGGAGAGCGACCTGTGAGGCCCTTG
Exon27b 29679239 - 29679141
	GCCACCCTGAACAGAGACTCCCTTGGCCTCCCGGAGGGGCTGAGGAGCCCTGCCCCCACCCTGACTCTGTATCTATGCAAAGAGCTCTTTGTGGTCCTT
Exon27c 29679140 - 29678273
	CTAGGGGGTCAGGCAGGGAGGGGCTAGGCAGGCCTCTCTTTCTCAGTCTTGTAGGGGAGGGAGGCTTGGCAATCAGCATTTCTGGTCTGCTAAATATATA
	CGCTGTGCTGTGGGTTCTTAGCCGATTGGAGGGGACAACGGACTCCTGTGCCCCAGAGATACCTTCCTATCCCAGGTCCCCTCTGCCCCTGAGGCCCCTT
	CAAAGCCTCTCACATCTAGGCCAAAGCCCCATGTGCCTTGTCCAGGAACCGCCTGCCCTAAGAAGTCCAGCAGAGGGCACCCAGCTCCCCTGGACCAGAT
	TCCAGTGGCTCCTCCCAGGAGCAGAGGACCTGCCATAGCCCTTCTCTGCCTCAGGAGTGGCTGCGGGGCAATCAGCCCCAGCCCACCTGGCCTCTGAGTC
	TCAGATTTTCTAAGGACCAAAACCAACAAAACACAAAGAATGGAACAGAAACAAACAAAAAAATCATTTaaaaaaaaaaaaaggaaaaaaaaaacttaaa
	aaaaaaaagaaaaCTTTAAAAACTTAAGACCTTCCAGAGAATTACTATTTACTTTATTAACTTACGGatttattatataaatatatatCCATCTAGCTGC
	ATATCTCTGCCACCTCTCTCACTCTCATAATGAAGACATAGCTGATTCAATGCCCTCCCCAGTCCCTCCTGATTTTCCCCTCGTGGCGGTGGGCAGAGGT
	CTCTGGGGACCTTCTGAGGTGGAGGCAGGCTGCTGGCCTGCCTGCCTGGTCGTTAATGGGTTTCTCTCCACTCGCCCCCTTGAGTTTATTCTGATTGATT
	TTTATTTTCTTGGTTTCTGGATAAACCACCCTCTGGGGATGGGAGAATAAAACATGTAATATTTTTAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
14+347dbEST_AA013805.1,dbEST_BQ960358.1,dbEST_BQ879385.1,dbEST_BQ890933.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,
24+2dbEST_BE286803.1,ENSMUST00000148196,
34+3dbEST_BF182509.1,dbEST_AW761998.1,ENSMUST00000140622,
45+336dbEST_BQ944903.1,dbEST_BI647839.1,dbEST_BM944125.1,dbEST_BU613607.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,GB_U41415.1,
56+250dbEST_CV783870.1,dbEST_BI555197.1,dbEST_CF737492.1,dbEST_BQ944903.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,GB_AK189589.1,GB_AK199777.1,GB_AK215382.1,GB_AK191304.1,GB_U41415.1,
67+198dbEST_CN529751.1,dbEST_CV783870.1,dbEST_AW211774.1,dbEST_BI157368.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,GB_AK189589.1,GB_AK199777.1,GB_AK215382.1,GB_AK191304.1,
78+179dbEST_BI558439.1,dbEST_BG863737.1,dbEST_CF740070.1,dbEST_BF534876.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,
89+146dbEST_CX217388.1,dbEST_BI558439.1,dbEST_BI645848.1,dbEST_BG863737.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,
910+127dbEST_CX217388.1,dbEST_BQ108924.1,dbEST_CF900400.1,dbEST_BI558439.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,
911+14dbEST_CN529751.1,dbEST_CK621779.1,dbEST_CD354981.1,dbEST_BQ745299.1,
1014+113dbEST_BI659916.1,dbEST_DV651357.1,dbEST_BI555550.1,dbEST_DT907714.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,
1114+12dbEST_BQ442664.1,dbEST_BI734050.1,dbEST_CN529751.1,dbEST_CK621779.1,
1314+3dbEST_BY716638.1,ENSMUST00000144909,GB_AK030237.1,
1214+2dbEST_BI248745.1,ENSMUST00000150493,
1415+146dbEST_BI694382.1,dbEST_BQ442664.1,dbEST_CF730874.1,dbEST_BG974432.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK030237.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,GB_AK201509.1,GB_AK202682.1,
1516+124dbEST_CK334510.1,dbEST_BQ946911.1,dbEST_BI688866.1,dbEST_BI655964.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK030237.1,GB_AK150044.1,GB_DQ303411.1,GB_AK211546.1,GB_AK192806.1,GB_AK193386.1,
1617+121dbEST_BG066428.2,dbEST_CK334510.1,dbEST_C79156.1,dbEST_CB575896.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK030237.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,GB_AK199782.1,GB_AK212291.1,GB_AK217326.1,GB_AK219364.1,GB_AK211546.1,
1718+122dbEST_BG066428.2,dbEST_CK334510.1,dbEST_C79156.1,dbEST_BM230965.2,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK030237.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,GB_AK199782.1,GB_AK212291.1,GB_AK217326.1,GB_AK219364.1,GB_AK211546.1,
1819+127dbEST_BG066428.2,dbEST_CK334510.1,dbEST_C79156.1,dbEST_BM230965.2,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK030237.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,GB_AK197401.1,GB_AK199718.1,GB_AK201098.1,GB_AK212723.1,
1920+153dbEST_BM230965.2,dbEST_BQ947681.1,dbEST_BI853188.1,dbEST_BI645781.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK030237.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,
2021+138dbEST_AW764006.1,dbEST_BM230965.2,dbEST_BI656146.1,dbEST_BI650068.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK030237.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,
2122+132dbEST_AW212322.1,dbEST_AW764006.1,dbEST_BI652049.1,dbEST_BQ936339.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK030237.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,
2223+141dbEST_BI652049.1,dbEST_BG242696.1,dbEST_BQ936339.1,dbEST_BF142407.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK030237.1,GB_AK077839.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,GB_AK177458.1,GB_AK189688.1,GB_AK180678.1,GB_AK183379.1,GB_AK186329.1,GB_AK189613.1,
2324+130dbEST_CF738752.1,dbEST_BI411926.1,dbEST_BI557628.1,dbEST_BI525578.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK030237.1,GB_AK077839.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,
2325+1dbEST_BI739746.1,
2426+122dbEST_CF738752.1,dbEST_BG915187.1,dbEST_BQ937673.1,dbEST_BI411926.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK030237.1,GB_AK077839.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,GB_U41416.1,
2627a+155dbEST_BI081373.1,dbEST_CF738752.1,dbEST_CK337212.1,dbEST_CK338557.1,REF_NM_021895.2,GB_AJ289242.2,GB_AK145322.1,GB_BC027032.1,GB_BC087554.1,GB_BC013616.1,GB_AK030237.1,GB_AK077839.1,GB_AK150044.1,GB_DQ303410.1,GB_DQ303411.1,GB_U41416.1,
27b1-3dbEST_CK338557.1,dbEST_BG915187.1,NIA_C0653A11-3,