NIA Mouse Gene Index (mm92)

Exon structure for U129911

chr19 -

Exon1 24365398 - 24364566
	GGGCACGTTCGTTATCGTATTCCTTTCTGCTCTTTGACGCTGCAGAGGAAGCATCGCTGAAGGCTCTCGTAACTCTACCATCATGTCTAAGTCCGAGTCT
	CCCAAGGAGCCAGAACAGCTGTGGAAGCTCTTTATTGGAGGGCTGAGCTTCGAAACAACCGACAAGAGTCTGAGGAGCCATTTAGAGCAATGGGGAACAC
	TAACCGACTGTGTGGGAATGAGAGATCCAAACACCAAGAGATCCAGGGGCTTTGGGTTTGTCACATACGCCACTGTGGAAGAAGTGGATGCTGCCATGAA
	TGCAAGACCACACAAGGTGGATGGAAGAGTTGTGGAACCTAAGAGAGCTGTCTCAAGAGAAGATTCTCAGTGACCAGGTGCCCAGTTAACTGTGAAAAAG
	ATCTTTGTTGGTGGTATTAAAGAAGACACTGAAGAACATCACCTACGAGATTATTTTGAGCAGTATGGGAAGATTGAAGTGGTAGAAATTATGACTGACA
	GAGGCAGTGGGAAAAAGAGGGGCTTTGCTTTTGTTACCTTTGATGACCATGACTCTGTGGATAAGATTGTTATTCAGAAATACCATACTGTGAATGGCCA
	CAACTGTGAAGTAAGAAAGGCTCTGTCGAAGCAAGAGATGGCTAGTGCTTCATCCAGCCAGAGAGGTCGCAGTGGTTCTGGAAACTTtggtggtggtcgt
	ggaggcggttttggtggcaatgacaattttggtcgaggagggaacttcagtggtcgtggtggctttggtggcagccgtggtggtggtggatatggtggca
	gtggggatggctataatggatttggcaatgacg
Exon2a 24364414 - 24364257
	TGGAAGCAATTTTGTAGGTGGTGGAAGCTACAATGATTTTGGCAATTACAACAATCAGTCTTCAAATTTTGGACTGAAGAAGGGAGGAAACTTTGGAGGC
	AGGAGCTCTGGCTCTTATGGTGGTGGAGGCCAGTACTTTGCTAAACCACGAAACCAAG
Exon2b 24364256 - 24364187
	GTGGCTATGGCGGTTCCAGCAGCAGCAGTAGCTATGGCAGTGGCAGGAGGTTCTAATTACGTACAGCCAG
Exon2c 24364186 - 24364156
	GAAACAAAGCTTAGCAGGAGAGGAGAGCCAG
Exon2d 24364155 - 24363485
	AGAAGTGACAGGGAAGCTACAGGTTACAACAGATTTGTGAACTCAGCCAAGCACAGTGGTGACAGGGCCTAGCTGCTACAAAGAAGACATGCTTTAGACA
	ATACTCATGTGTGTGGGCAAAAACTCCAGGACTGTATTTGTGACTAATTGTATAACAGGTTATTTTTAGTTTCTGTTCTGTGGAAAGTGTAAAGCATTCC
	AACAAAAGGTTTTACTGTAGACCTTTTTCACCCAGGATGTTGATTGCTAAATGTAATAGTCTGATCATGACGCTGAATAAATGTGTCTTTTTTTTTTTAA
	ATGTGCTGTGTAAAGTTAGTCTATTCTGAAGTCATCTTGGTAAACTTCCCCAACAGTGTGAAGTTAGAATTCCTTCAGGGTGGTGCCAAGTTCCATTTGG
	AATTTATTTATGGTTGCTTGGGTGGAGAAGCCATTGTCTTCAAAAACCTTGATGTCGTTAAACTGCCAGTTACTATTGTAACTTTTAATGAGTTTCACCA
	TTGAAAGGGTCATCCAAGCAAGGTCACAATTTGGTTATAAAATGGTTGTTGGCACACGCTATGCAATATCAAAATTGAATAATGGTATCAGATAAAATAA
	CAGATGGGAATGAAACTTATGTATCCATTATCATGTGTACTCAATAAACGATTTAATTCTCTTGAAAAAAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12a-9ENSMUST00000117081:5,ENSMUST00000168019:5,ENSMUST00000050143:5,ENSMUST00000087351:5,
12b+1ENSMUST00000040649:5,
2b2d-1NIA_L0285F01-3:7,