NIA Mouse Gene Index (mm92)

Exon structure for U158818

chr6 +

Exon1 30491582 - 30491729
	GAGTCAATAGAGAGCTCTCAGCCCTGCTCCCTATAAAGTTCAGGAAGGGCTCTGAACTCTGGACTCTGGGAAAAGCATTGACCATGAGGTTGACCCCGTT
	ATTGGTTGCCCTATTTGGGTATATCTACTGTCAAGAAACATTTGTGGG
Exon2 30493786 - 30493900
	GAACAGACAAGTCTTAGAAGCCAGTGCTTTATGAGCAGCAGGTGTTGTTTGACAAATACTCATTAGCTCACGGAAAGGGAACTTTAACGGCAAGCAAGCT
	TCCTGCTAGGAGCAG
Exon3a 30494135 - 30494216
	AGATCAAGTTCTTGAGGTGATCCCGAATGATGAAGAGCAAATTAAGACTCTGCTGCAACTGGAGGCCGAAGAGCACCTTGAG
Exon3b 30494217 - 30494442
	GTATTGGTCATCCCATCAGCATTTTCTCTCTTCAGTAAATAAAGTCGGCGCGATTGGCAGCTACTTCGGGTCTGTAGTTTGACTCCTTGGAGGTAATGTG
	GGATGCCGACTCCTAGAACCTGGACTTTAGCTCCAACTCTACAGCCCCGAGCAAATGGCCTTCTTTCCCGGTGATTCATTTTCACAATCAGAAAACTGAG
	GAAAAATATATCATTCTTCATATCTC
Exon4a 30494891 - 30494913
	CTTGATTTTTGGAAATCCCCCAG
Exon4b 30494914 - 30495025
	CGTCCCCAGGCAGACAGTCCATGTCCGAGTTCCTTTTGCCAGCATCCAGGACGTCAAAGTTTTCCTGGAGTCCCAGGGGATTACTTATTCCATCATGATC
	GAAGATGTTCAA
Exon5 30495504 - 30495599
	GTTCTGTTGGATCAAGAGCGTGAAGAGATGCTGTTCAACCAGCAAAGAGAGCGTGGCACTAACTTCAACTTTGGGGCCTACCATACCCTGGAAGAG
Exon6 30497105 - 30497206
	ATTTACCAAGAAATGGATAACCTCGTGGCTGAGAACCCTGGTCTAGTGAGCAAAGTGAATATCGGTTCATCTTTTGAAAATCGGCCCATGAATGTGCTCA
	AG
Exon7 30499242 - 30499340
	TTCAGCACCGGAGGAGACAAGCCAGCCATCTGGCTTGATGCGGGGATCCACGCTCGAGAGTGGGTTACGCAAGCTACTGCACTGTGGACAGCAAATAAG
Exon8 30500745 - 30500855
	ATTGCGTCTGATTATGGGACTGATCCAGCCATCACTTCTCTTCTCAATACTCTGGATGTCTTCCTGCTGCCTGTCACGAACCCTGATGGATATGTGTTCT
	CCCAAACCTCC
Exon9 30501966 - 30502056
	AATCGTATGTGGCGAAAGACCCGGTCTAAACGGTCGGGAAGCTTCTGTGTTGGTGTGGATCCTAATCGGAACTGGGACGCAAATTTCGGAG
Exon10 30504164 - 30504363
	GACCTGGAGCCAGTAGCAACCCTTGCTCTGATTCATACCATGGACCCAGTCCCAATTCTGAAGTTGAAGTGAAATCCATAGTGGACTTCATCAAGAGCCA
	CGGGAAAGTCAAAGCGTTCATTACCCTTCACAGCTATTCCCAACTGCTCATGTTCCCCTATGGCTATAAATGTGCCAAGCCAGATGACTTTAATGAGCTG
Exon11 30507672 - 30507756
	GATGAAGTGGCCCAAAGGGCTGCCCAGTCTTTGAAAAGACTCCACGGCACCAGTTACAAAGTGGGACCCATCTGTTCTGTCATCT
Exon12 30514238 - 30514476
	ACCAGGCCAGTGGCGGAAGCATCGACTGGGCTTATGACCTTGGCATCAAATACTCATTTGCCTTTGAACTGAGAGACACAGGCTACTATGGCTTCCTCCT
	GCCAGCCAAGCAGATCTTGCCCACAGCAGAAGAGACCTGGCTTGGCCTGAAGACCATCATGGAGCACGTACGAGACCACCCCTACTAGGGACATACAGAA
	CAGATGAACACTATTAAAATCTCTGTGGTATAAGCACAA

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+2dbEST_BM570096.1,ENSMUST00000131137,
13a+144dbEST_BG311302.1,dbEST_BM877414.1,dbEST_BY716897.1,dbEST_BM877808.1,REF_NM_001024698.2,GB_BC094929.1,
23a+6dbEST_BM570096.1,dbEST_BU512490.1,dbEST_CK788348.1,ENSMUST00000131137,
3a4a+152dbEST_BG311302.1,dbEST_BM877414.1,dbEST_BI319590.1,dbEST_BU788911.1,REF_NM_001024698.2,GB_BC094929.1,
3a4b+1dbEST_CO428705.1,
4b5+150dbEST_BG311302.1,dbEST_BM877414.1,dbEST_BQ418432.1,dbEST_CA951324.1,REF_NM_001024698.2,GB_BC094929.1,
56+137dbEST_BG311302.1,dbEST_BM877414.1,dbEST_BI466018.1,dbEST_BB847841.1,REF_NM_001024698.2,GB_BC094929.1,
67+81dbEST_BG311302.1,dbEST_BI714223.1,dbEST_BI794132.1,dbEST_BM875103.1,REF_NM_001024698.2,GB_BC094929.1,
78+36dbEST_BY716935.1,dbEST_BB610349.1,dbEST_CF580368.1,dbEST_BG321828.1,REF_NM_001024698.2,GB_BC094929.1,
89+21dbEST_CF580368.1,dbEST_CF587083.1,dbEST_BU510502.1,dbEST_CO428705.1,REF_NM_001024698.2,GB_BC094929.1,
910+68dbEST_BU510502.1,dbEST_CO428705.1,dbEST_BG310992.1,dbEST_BQ287739.1,REF_NM_001024698.2,GB_BC094929.1,
1011+106dbEST_BM502540.1,dbEST_BG270670.1,dbEST_BM505844.1,dbEST_BM502380.1,REF_NM_001024698.2,GB_BC094929.1,
1112+107dbEST_BG270670.1,dbEST_BM502380.1,dbEST_BQ416509.1,dbEST_BG881070.1,REF_NM_001024698.2,GB_BC094929.1,