NIA Mouse Gene Index (mm92)

Exon structure for U236712

chr6 -

Exon1 42547692 - 42547413
	AGTTGGAACTGATACGCGTATGAAAACAAAAGGATTTGTGTGCACCAGAGAAGTCTGGTCTGGGGTCAGCCACGGGGATCAATACAGCTCTTATACATGA
	ACAGTAGCTTTAACTGCAGTGTCTGGTGGGCAGCAGGGGGCCAGAAGAGAGGAGAGCTAACACAATGAAAGAACGTCATAGTGAGCATCTGGGTGGAAGT
	AGGAAAGAAATAGCAAGAAAGAACTGAGTTGTGAACATACATCCTGAGAATGAAGCGCCTCAGATGAAATCAAAGGAGAG
Exon2 42547289 - 42546653
	CAGCTGGCAGAACCATGGCAACAACCCCTGATGCTGCTTTTGAGACCCTCATGAATGGAGTGACCAGCTGGGATCTTCCCAAAGAACCCATTCCCAGTGA
	ACTTCTCCTTACTGGGGAGTCAGCCTTCCCAGTGATGGTGAATGACAAGGGCCAGGTGCTCATTGCTGCCTCTTCCTATGGACAAGGCCGCCTGGTGGTC
	GTATCCCATGAGAGCTACCTGCTGCACGATGGCTTGGTTCCATTTCTTCTCAATGTGGTGAAATGGCTCTGCCCCTGCCCAGGGGCTCCCATAGCGGTGC
	ATTCTTCCTTAGCATCATTAGTTAACATCCTAGGTGATTCTGGGATAAATGCCTTGGTTCAGCCTGAGCCTGGAGAGGCTCTGGGAGTTTATTGCATTGA
	TGCCTACAATGATGCCTTGACTGAGAAGCTGATCCAATTCCTGAAGAATGGAGGAGGTTTGCTAATTGGAGGCCAGGCTTTGAATTGGGCTGCTCACCAT
	GGCCATGATAAAGTGCTATCCATTTTTCCTGGAAACCAGGTGACAAGTGTGGCTGGAGTATATTTCACTGATATCTCTGCGAATAGAGACTGGTTCAAGG
	TTTCTAAGGAGATACCCAATCTCAGACTCTATGTCCA
Exon3 42544192 - 42543228
	GTGTGAGGATGAGCTCGAGGACGACCAGCAGCAGCTCCTGAAAGGGATGTCTGAGATATACATCGAGGCGGGTGTAATCCCCTCCCAGCTGCTTGTGCAT
	GGACAGCGGGCATTTCCCTTGGGAGTAGACAATTCACTCAATTGCTTTCTTGCAGCTGCCCGCTATGGCCGTGGTCGGGTGGTGCTGGGGGGAAATGAGA
	GTCTCATACTTAATCAAACTATGCTGCCATTTGTGCTTAATGCTTTACACTGGCTGATGGGGAACCAGACAGGCAGAATTGGGTTAGCTTCAGATATGAA
	AGTACTGAAGTCTATGTTACCAAACAGCAGTTTCCAGTGGAGTGAATCAGAACTTCTAACCAGTGACTTGAGCGTGTTTTGCTGCTGCTCACTCGCCAAT
	ATAGATTCCGAGGAGGTAGAGGAATTTGTTGCAGAAGGTGGAGGCTTGCTAATTGGTGCAGAGGCCTGGTCGTGGGGCCGCAGGAATCCATACTCTAGCT
	GTATGACTCAATACCCAGATAACATCGTCCTTAAGCGCTTTGGCCTTGGTATCACTAGCCATGTGGCCCAGCGAGGCAGTTTCCCATTCCCCAATCCTGA
	AGGGACAAACTATCACTTTCGGAGAGCCCTGTCTCAATTTGAGTCCGTGATCTACAGCCGGGGGAGTAGCTTACACGAGAGCTGGCTGAATAAGCTCTCA
	CAAGATTGTTTCTACATGTTTCAAATGACCCATCAGAGGATTTCCATCTACGACTCTGTGAAGAAACATGCTCTGAAAATGATCCAAAGCAAGGACTTTC
	CAAGTGTGACTGAACAATACCCGATCGCAAGGGGCAGCTCACAGGCTTTTCTTCTATCCCTGGCTTATGAATTATTCAAATCCGGAGTTGACAGATCTCA
	GCTACTTCCCCCTCCCGCCTTACTACCTCCTACAGAATCTCCAATAACCATTAAAATAAGCACAG
Exon4 42542948 - 42542851
	ACAATGACAACTCCTGGGTGAGCACTGGACTGTACTTACCTGAAGGGCAGGTTGCACAAGTATTACTTCCCAGTGAAGCTACTCATGCCAAGCTGAAG
Exon5 42542024 - 42541811
	GTCCTCATTGGCTGCCACAGGGACAACATAAGCCAAGCAAGAACTTACTTCCGTCCCCCTGTGATGACCTATGTGTACCACTTAACTTCATCCCAGACAT
	CCATCTCCTGGCTCTATGGGGGCCTTCTCTACATCATGGTCCCCAACAAATATAATCAGGATAATGTGTCTGTCACCATCCGTGGGGCTGTATCTGCTCC
	ATACTTCAGGCTGG
Exon6 42541519 - 42541280
	GTAAGACGACCCAGGAGGAATGGAAGAATCTTATCACACACAGCAAAGCTCCGTGGGGAGAACTAGCCACAGACAATATCATCCTGACAATTCCAACGGT
	AAACCTCAAGGAGCTTCAGGACCCCTATCCACTGCTCCAACTCTGGGACAAGATGGTAAGGGCTGTAGCCAAGCTGGCAGCCCGGCCCTTCCCTTTTCAG
	AGAGCTGAGAGGGTCGTACTTGACAAGCAGATTTCATTCG
Exon7 42540012 - 42539675
	GTTTCCTTCATTCTGGATACCCCATCATGGGCCTAATTAGTATAGTAGAAGGCATCATCAGCGAGTTCAAAATAAGATCACATGGCATTTGGGGTGTGAT
	ACATGAACTGGGCCACAACCATCAGAAGTCTGGATGGACTTTTCCACCTCACACCACCGAAGCTTTGTGCAATCTCTGGACTATTTATGTGCATGAGACA
	GTTTTAAACATCCCCAGGGAGCAAGCCCATCCTTCTCTGAATCCTGAGCTTAGGAGGCAGAGGATCAAATACCACCTGAACAAGGGAGCACCTCTGAGCA
	ACTGGATTATGTGGACAGCTCTAGAAACTTATCTCCAG
Exon8 42537747 - 42537515
	CTCCAGGAGGGCTTTGGGTGGGAGCCATTCATCCAGGTCTTTGCTGACTACCGAACCCTCTCTGGCCTTCCTCAAAACAATGAAGACAAGATGAATCTGT
	GGGTGAAGAAGTTCTCTGAGGCTGTGCATAAGAATCTGGCACCTTTCTTTGAAGCCTGGGGCTGGCCTGTCAAATATGCTGTGGCTAAAAGCCTAGCCTC
	TTTGCCAGAGTGGCAGGAAAACCCCATGAAAAG
Exon9 42535167 - 42534865
	AACTCCCCTGCCTGCTGCTTGAGAAGTGTGGCACCCGTCCTCTCTCACAGAGAACCTTCTCCTGAATATGTGCTCCTGTGTCCATGTCTTTCTTTTGCTC
	CTATGACCTGGGTTCCAGCGTGTGAGGACAGTTAAACATAAAATAGCTTACGTCTGATGGAAATGTTGGCCAGGATGATAAATGATTCAAAGAGTACcat
	ttattcctctcattgttgtgaccaagtatctaacagaagtgactcgaaggaggagaagtctatttctgttcatgatttcagaaaataaagtgcatcatgt
	cag

Links between exon parts

From
exon
To
exon
Splice
sites
SupportExamples
12+4dbEST_DV055204.1,dbEST_DV040391.1,dbEST_DV054723.1,ENSMUST00000134707,
23+6dbEST_DV056227.1,ENSMUST00000069023,ENSMUST00000134707,REF_NM_203396.1,GB_AY528666.1,GB_BC141450.1,
34+5dbEST_DV053391.1,ENSMUST00000069023,REF_NM_203396.1,GB_AY528666.1,GB_BC141450.1,
45+5dbEST_DV055067.1,ENSMUST00000069023,REF_NM_203396.1,GB_AY528666.1,GB_BC141450.1,
56+8dbEST_DV055067.1,dbEST_DV056624.1,dbEST_DV056623.1,dbEST_DV051541.1,REF_NM_203396.1,GB_AY528666.1,GB_BC141450.1,
67+11dbEST_DV055067.1,dbEST_DV051697.1,dbEST_DV051881.1,dbEST_DV056624.1,REF_NM_203396.1,GB_AY528666.1,GB_BC141450.1,
78+10dbEST_DV054311.1,dbEST_DV051697.1,dbEST_DV051881.1,dbEST_DV056624.1,REF_NM_203396.1,GB_AY528666.1,GB_BC141450.1,
89+2dbEST_DV049171.1,ENSMUST00000151898,